Bio Basic - PRIMER.COVID-19-1 - CCCTGTGGGTTTTACACTTAA Coronavirus Primers

Neobits.com is where business goes shopping. With over 5 million products from 10,000+ manufacturers, we offer the largest B2B catalog on the internet (to our knowledge). We cater to the needs of all major verticals, small to large businesses, government, education and healthcare markets, as well as consumers. Through our extensive, carefully developed supplier and logistics network we have instant access to over $100 billion worth of inventory in hundreds of stocking warehouses nationwide. We ship to every state and to nearly 100 countries worldwide.

Our categories include Industrial & Scientific, MRO Products & Supplies, Laboratory & Science, Electronic Components, Occupational Health & Safety, Electronics, Computer & Photo, Access Control & Security, Wireless Carrier Infrastructure, Test & Maintenance, and thousands more. That said, the best way to find products on our website is via search. We are always expanding our catalog, with thousands of new products added daily. If you need something you don't see here, email us at sales@neobits.com, or call toll free 1.866.636.2487. Prospective new suppliers, please email vendors@neobits.com.

We can send formal quotes or bids upon request. Please submit this form to request a quote. We often have volume discounts, government & education discounts and loyalty discounts. We accept purchase orders from government and public education entities, as well as publicly traded corporations. CAGE Code: 3P0S1.

We are continually investing in people and systems to offer excellent customer service. See some customer testimonials here. You can reach our Customer Care team via email at customercare@neobits.com, or call toll free 1.866.636.2487. The best way to request a return or order cancellation is to submit this form.

Also see: Categories, Products, Brands and Top Searches.