Image is an illustration, may not reflect the exact product sold.


Other products by Merck

Merck - 70005-3 - 70005-3, T7SelectUP Primer

  • MFR SKU: 70005-3
  • ITEM #: 6311202
  • 0 Reviews / 0 Questions
$185.95
Stock Status: SHIPS SOON (reserve your unit today)
Average lead time for this brand: 2-3 weeks. Specific products may vary.

ITEM #: 6311202
T7Selectup Primer 3^ T7Select Vector primers are convenient for amplification and sequencing of T7Select recombinants, and are compatible with all T7Select vectors. Mr: 6105, Storage -20degreeC
This listing is for Each

Merck - 70005-3 - 70005-3, T7SelectUP Primer

  • Item #: 6311202
  • MFR SKU: 70005-3
  • Overview T7Select Vector primers are convenient for amplification and sequencing of T7Select recombinants, and are compatible with all T7Select vectors.
  • M r : 6105
  • Catalogue Number 70005
  • Brand Family Novagen®
  • Oligo seqence 5 - GGAGCTGTCGTATTCCAGTC - 3
  • Quality Level MQ100
  • Ship Code Shipped with Blue Ice or with Dry Ice
  • Toxicity Standard Handling
  • Storage -20° C
  • Avoid freeze/thaw Avoid freeze/thaw
  • Do not freeze Ok to freeze

There are no questions about this product yet. Be the first to ask a question.

0 out of 5 stars
5 Star
0 %
4 Star
0 %
3 Star
0 %
2 Star
0 %
1 Star
0 %

Review this product

Tell us about your personal experience

Recently Viewed Items